site stats

Myh6 mercremer

WebSimilarly, age and gender-matched Myh6- MerCreMer+; Tead1W/Wmice were used as an additional control.All 3 groupsofmicewere receivedTAM injection in the same way as for igKO mice except with lower... Web27 nov. 2024 · In this system, Myh6-MerCreMer:R26R-Confetti-labelled cells and their daughter cells could express one of four different fluorescent reporters: nGFP, YFP, RFP or mCFP. Fig. 4 Gel–miR-302-induced...

RNA-binding protein QKI governs a muscle-specific alternative …

WebMice bearing either floxed Ulk1 or floxed Ulk2 alleles were crossed with transgenic mice expressing a tamoxifen-inducible Cre recombinase (Myh6-MerCreMer). Gene … WebExpression of Myh6 was unaffected by miR302-367 overexpression ( Fig. 3E ). Overexpression of miR302-367 in developing cardiomyocytes therefore led to a highly proliferative, immature dedifferentiated phenotype in cardiomyocytes. In contrast, miR302-367 overexpression resulted in down-regulation of programmed cell death ( Fig. 3D ). creed bike lights https://jfmagic.com

Generation of Myh6MerCreMer/+ knock-in mouse. (A

Webreferred to as MerCreMer (MCM), is expressed[4,5]. Administration of tamoxifen (TAM) or 4-hydroxytamoxifen activates the MCM protein, leading to its nuclear translocation and … Web17 mrt. 2024 · In fact, Zhang et al. exploited this aspect of cardiomyocyte response to injury in their experimental strategy to identify “dedifferentiating” cardiomyocytes, noting that … Web1 jul. 2011 · To circumvent this limitation, a widely used inducible cardiac-specific model, Myh6 -MerCreMer (Cre), using tamoxifen (TAM) to activate Cre has been developed. The current study examined cardiac function in Cre-positive C57B/J6 mice exposed to one, three, or five daily doses of a 40 mg/kg TAM to induce Cre activity specifically in the heart. buckner\u0027s bourbon

Neonatal Heart Regeneration: Comprehensive Literature Review.

Category:Cardiomyocyte-specific deletion of leptin receptors …

Tags:Myh6 mercremer

Myh6 mercremer

Tg (Myh6-cre/Esr1*)1Liao Transgene Detail MGI Mouse …

Web31 jul. 2014 · Notably, Myh6 (α-MHC)-MerCreMer transgenic mice, 1 where Cre activity is induced by the application of tamoxifen or raloxifene, have become a valuable tool for … Web23 jul. 2015 · Myh6 MerCreMer/+ Hearts Display Normal Structure and Function before and after Tamoxifen Induction. Given that Myh6 MerCreMer/+ is a knock-in/knock-out allele …

Myh6 mercremer

Did you know?

Web18 dec. 2024 · During the past two decades, experiments utilizing constitutive as well as tamoxifen-activated Myh6-driven Cre recombinase transgenes have driven remarkable … Web23 jul. 2015 · Mhy6 encodes a cardiac muscle specific protein: alpha-myosin heavy chain. Here, we generated a new Myh6-MerCreMer (Myh6MerCreMer/+) inducible Cre knock …

Web5 mrt. 2024 · Myh6-MerCreMer:LARP7 f/f mice were injected with 25 mg/kg/d tamoxifen (iCKO) for continuous 5 days at 2 months of age to deplete LARP7 from cardiomyocytes. … WebMyh6-MerCreMer [B6.FVB(129)-A1cfTg(Myh6-cre/ Esr1*)1Jmk/J, Jackson Laboratory, 005657] mice. We then generated doubletransgenic Myh6- -MerCreMer: :Rosa26fs …

Web18 dec. 2024 · Myh6-driven Cre recombinase activates the DNA damage response and the cell cycle in the myocardium in the absence of loxP sites. Regeneration of muscle in the … Web23 jul. 2015 · Here, we generated a new Myh6-MerCreMer (Myh6(MerCreMer/+)) inducible Cre knock-in mouse by inserting a MerCreMer cassette into the Myh6 start codon. By …

Web7 mrt. 2024 · Furthermore, we generated Myh6-merCremer;Thra DN/+ mice and induced DN-TRα expression around the perinatal window (fig. S10). Increased prevalence of diploid proliferative cardiomyocytes was also observed in these mutants (fig. S10).

Web23 okt. 2024 · Myh6-MerCreMer+/+ AKAP2fl/fl mice. The presence of the MerCreMer transgene was confirmed by PCR, using the Cre-F sense primer (ATACCGGAGATCATGCA AGC) and the Cre-R anti-sense primer (AGGTGGACCTGATCATGGAG). 2.2. Animal Procedures All animal experiments were … creed birdbuckner\u0027s braceWeb6 dec. 2024 · Myh6-MerCreMer mice with 4-OH tamoxifen injection were used as control ( Supplementary material online, Figure S4 ). Impaired GRK4 activity in heart tissue of conditional cardiomyocyte specific GRK4 knockout mice was revealed by detecting DRD1 phosphorylation ( Supplementary material online, Figure S2C ). buckner\\u0027s bourbon reviewWeb22 mrt. 2024 · Heart disease is the leading cause of death worldwide. The major cause of heart failure is the death of the myocardium caused by myocardial infarction, detrimental … buckner\u0027s children\u0027s homeWeb22 jul. 2015 · (A) Schematic diagram of gene targeting. The MerCreMer-FRT-Neo-FRT cassette was inserted into the Myh6 locus (6 bp upstream ATG). The Neo cassette was … buckner\\u0027s bourbonWebMoreover, the number of PH3 + cardiomyocytes was significantly higher in Myh6 mercremer:R26R-miR302-367 Tg/+ hearts than in Myh6 mercremer controls 3 weeks … buckner\\u0027s braceWebMice bearing either floxed Ulk1 or floxed Ulk2 alleles were crossed with transgenic mice expressing a tamoxifen-inducible Cre recombinase (Myh6-MerCreMer). Gene recombination in the Ulk1 flox/flox; Myh6-MerCreMer + mice (i.e., icU1-KO) and Ulk2 flox/flox; Myh6-MerCreMer + mice (i.e., icU2-KO) were induced buckner\\u0027s cave bloomington indiana